Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г icon

Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г




Скачати 84.66 Kb.
НазваМінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г
Дата12.08.2012
Розмір84.66 Kb.
ТипДокументи


ЕКСПРЕСІЯ Р-СЕЛЕКТИНУ, ТКАНИННОГО ФАКТОРА ТА ЕНДОТЕЛІНУ-1 В ЕНДОТЕЛІАЛЬНИХ КЛІТИНАХ ПОВЗДОВЖНЬОЇ АРТЕРІЇ: ВПЛИВ ПРОПОФОЛУ


Мінченко Д.О., Сенченко Т.Ю., Безродний Б.Г.. Мінченко О.Г.


Інститут біохімії ім. О.В. Палладіна Національної академії наук України (м. Київ): Національний медичний університет ім. О.О. Богомольця (м. Київ):


Р-селектин, тканинний фактор та ендотелін-1 є надзвичайно важливими факторами, що визначають функцію ендотеліальних клітин та системи гемостазу. Р-селектин синтезується переважно в ендотеліальних клітинах та тромбоцитах і зберігається у тільцях Weibel-Palade в ендотеліальних клітинах, а в тромбоцитах - в а-гранулах. Він є мембранним глікопротеїном, але експресується на поверхні клітини лише під впливом ряду чинників (запалення, спазм артерії, гіперглікемія) і опосередковує взаємодію моноцитів та нейтрофілів з цими клітинами шляхом зв'язування з специфічним глікопротеїдним лігандом (рецептором) Р-селектину (SELPLG або PSGL-1). Р-селектин ініціює прокатку (ролінг) лейкоцитів по ендотелію. їх адгезію та інфільтрацію в тканини [1 - 4]. Р-селектин та SELPLG відіграють важливу роль у процесах взаємодії ендотеліальних клітин з клітинами крові, коагуляції та тромбоутворення, в тому числі і в атеросклеротичних бляшках, а порушення їх експресії може бути одним із факторів розвитку патологічних станів [5 - 10].

Тканинний фактор є також мембранним глікопротеїном. який має три домени (цитоплазматичний, трансмембранний та позаклітинний), взаємодіє з фактором згортання крові VIIa, що приводить до активації факторів X і IX та ініціації згортання крові [11]. В нормальних умовах тканинний фактор не експресується в ендотеліальних клітинах і моноцитах, але під впливом бактеріальних ендотоксинів, фактора некрозу пухлин та ряду інших чинників ініціюється його експресія на рівні транскрипції гена. Експресія тканинного фактора є залежною і від Р-селектину. а його активність контролюється двома інгібіторами - інгібітор шляху тканинного фактора (TFPI) та інгібітор шляху тканинного фактора-2 (TFPI-2), причому було встановлено, що активність TFPI залежить від протеїну S і що TFPI з протеїном S є головними регуляторами утворення тромбіну [12 - 14]. TFPI є глікозильованим протеїном і переважно знаходиться в клітинах ендотелію та у плазмі крові у вільній або зв'язаній з ліпопротеїдами формі. Було показано, що травматичний шок призводить до вираженого посилення експресії тканинного фактора і що низькомолекулярний рекомбінантний ліганд Р-селектину rsPSGL.lg суттєво зменшує його експресію [4, 14, 15].

Ендотелін-1 є потужним регулятором тонусу судин, він утворюється і секретується ендотеліальними клітинами судин, його експресія суттєво змінюється в умовах травматичного шоку, його регуляторний вплив реалізується через два типи рецепторів, причому ендотелін-1 відіграє певну роль також і у функціонуванні нервової системи [16 -18].

Пропофол (propofol, diprivan) знайшов широке використання в анестезіології, але застосовується і у якості седативного препарату, хоча є випадки ряду ускладнень [19]. Разом з тим, детального дослідження його можливого впливу на ендотелій судинної системи на рівні експресії ендотеліну та ключових факторів згортання крові до цього часу не було проведено.

Метою даного дослідження було вивчення експресії мРНК Р-селектину. тканинного фактора та ендотеліну-1 у культурі ендотеліальних клітин повздовжньої артерії при дії на них різних доз пропофолу протягом перших шести годин та у більш віддалені строки (16 та 24 години).

Культура клітин. Досліди проводили на культурі ендотеліальних клітин повздовжньої артерії, які отримували і ростили як було описано раніше [20]. Клітини ростили в присутності різних доз пропофолу (30 або 300 мкМ) протягом 3. 6. 16 та 24 годин і виділяли з них РНК.

Виділення РНК. Тотальні РНК виділяли із культури ендотеліальних клітин з допомогою реагенту Трізол (Trizol; Invitrogen, USA) згідно протоколу виробника, як описано раніше [21]. Осаджували РНК рівним об'ємом 2-пропанолу. Осади РНК промивали двічі 75 % етанолом і розчиняли у воді, що не містила домішок рибонуклеаз.

Аналіз експресії мРНК Р-селектину, тканинного фактора та еидотеліну-1. Експресію мРНК Р-селектину та ендотеліну-1 досліджували методом молекулярної РНК-РНК гібридизації, як описано раніше [14. 16]. Крім того, експресію мРНК Р-селектину. тканинного фактора та ендотеліну-1 досліджували також методом кількісної полімеразної ланцюгової реакції (у реальному часі). Для цього тотальну РНК із ендотеліальних клітин використовували як матрицю для синтезу комплементарної ДНК (кДНК). яку проводили на апараті "Stratagene Міх 3000Р cycler" (США), використовуючи SYBRGreen Міх (АВ gene, Epson, Великобританія). Для цього тотальну РНК із артеріальних ендотеліальних клітин використовували як матрицю для синтезу комплементарної ДНК (кДНК) з допомогою набору "QuaniTect Reverse Transcription" (Q1AGEN, Німеччина), який забезпечував елімінацію можливих залишків геномної ДНК. Для цього 1 мкг РНК спочатку короткочасно (протягом 2 хвилин) інкубували з буфером gDNA Wipeout, а потім з Quantiscript зворотною транскриптазою в присутності суміші праймерів (Primers mix) та буферу, що уже містив інгібітор рибонуклеаз і набір чотирьох дезоксирибонуклеотидів. при 42°С протягом 15 хвилин. Реакцію зупиняли прогріванням реакційної суміші при 95°С протягом 3 хвилин і отриману кДНК використовували для проведення кількісної полімеразної ланцюгової реакції.

Для проведення полімеразної ланцюгової реакції були використані такі пари праймерів: для Р-селектину 5'- CACCAATGTGTGAAGCCATC -3' і 3'-ACATTGCACCCCTGGAGTAG -5', які відповідали нуклеотидним послідовностям 1756-1775 та 1991-1972 кДНК Р-селектину (SELP) людини (GenBank номер NM_003005) та для тканинного фактора 5'- GACCTCACCGACGAGATTGT -3' і 3'-CCGAGGTTTGTCTCCAGGTA -5', які відповідали нуклеотидним послідовностям 447-466 та 601-582 кДНК тканинного фактора (coagulation factor III) людини (GenBank номер NM_001993); для ендотеліну-1 5'- CCAAGGAGCTCCAGAAACAG -З' і 5'-GATGTCCAGGTGGCAGAAGT -3'. які відповідали нуклеотидним послідовностям 379-398 та 547-528 опублікованої кДНК ендотеліну-1 (EDN1) людини (GenBank номер

NM 001955). Відносну кількість транскриптів Р-селектину, тканинного фактора та ендотеліну-1 розраховували по кількості транскриптів в-актину. Для ампліфікації [3-актину використовували наступні праймери: прямий - 5'- GGACTTCGAGCAAGAGATGG -3' та зворотний - 5'- AGCACTGTGTTGGCGTACAG -З'.

Для проведення кількісної полімеразної ланцюгової реакції використовували по три незалежно виділених препарати РНК. Аналіз результатів виконували з допомогою спеціальної комп'ютерної програми "Differential expression calculator" а статистичний аналіз - в Excel програмі.


^ Результати дослідження та їх обговорення

Експресія мРНК ендотеліну-1 та Р-селектину у культурі артеріальних ендотеліальних клітин по даним молекулярної РНК-РНК гібридизації суттєво не змінюється через 3 та 6 годин дії пропофолу у концентрації як ЗО. так і 300 мкМ у порівнянні з контрольними клітинами, але різко підвищується при більш тривалій дії пропофолу (через 16 та 24 години).

Із даних кількісної полімеразної ланцюгової реакції видно, що експресія мРНК ендотеліну-1 в артеріальних ендотеліальних клітинах різко посилюється під впливом пропофолу в концентрації 30 мкМ (в 3.6 та 2,9 раз через 16 та 24 години, відповідно), порівняно з контрольними клітинами. Пропофол у концентрації 300 мкМ посилював експресію мРНК ендотеліну-1 в ендотеліальних клітинах повздовжньої артерії приблизно в такій же мірі, як і менша його концентрація: в 2,9 та 3,2 рази через 16 та 24 години, відповідно. Експресія мРНК Р-селектину в артеріальних ендотеліальних клітинах також різко збільшувалась під впливом пропофолу як у концентрації 30 мкМ, так і в концентрації 300 мкМ: в 3,5 та майже у 2,5 рази через 16 та 24 години дії пропофолу в концентрації 30 мкМ, відповідно, та в 2.7 і 3.1 рази через 16 та 24 години дії пропофолу в концентрації 300 мкМ. відповідно, при порівнянні з контрольними ендотеліальними клітинами.

Подібні, хоча і в меншій мірі виражені, зміни були виявлені в експресії мРНК тканинного фактора при дії різних концентрацій пропофолу на ендотеліальні клітини повздовжньої артерії. Експресія мРНК тканинного фактора збільшувалась під впливом пропофолу (30 мкМ) в 3,0 та 2,2 рази через 16 та 24 години дії, відповідно, а під впливом більшої концентрації пропофолу (300 мкМ) у 2,6 та майже у 2.5 рази через 16 та 24 години, відповідно, порівняно з контрольними клітинами.

Таким чином, в культурі ендотеліальних клітин повздовжньої артерії під впливом пропофолу змінюється експресія надзвичайно важливих регуляторних факторів, що контролюють функцію ендотеліальних клітин та системи гемостазу, в цілому: Р-селектину. тканинного фактора та ендотеліну-1 на рівні експресії їх мРНК. але не в перші шість годин дії пропофолу. а у більш віддалені періоди часу. Відсутність видимої різниці в ефекті меншої та більшої концентрації пропофолу на експресію всіх досліджуваних генів у культурі артеріальних ендотеліальних клітин можливо пояснюється тим, що максимальний ефект пропофолу досягається уже при концентрації у ЗО мкМ із-за високої чутливості генів Р-селектину, тканинного фактора та ендотеліну-1 його дії. Віддалена у часі реакція генів на дію того, чи іншого чинника широко відома, є гено-специфічною і залежить також від природи чинника. Оскільки є випадки і довготривалого використання пропофолу (до 48 годин) [19]. то значне посилення експресії ендотеліну-1. Р-селектину та тканинного фактора в артеріальних ендотеліальних клітинах, що спостерігається при дії пропофолу. може приводити до порушення системи гомеостазу і ініціації тромбоутворення.

Результати даної роботи свідчать про суттєві зміни в експресії ряду генів, що контролюють функцію ендотелію судин (Р-селектину. ендотеліну-1 та тканинного фактора) і що вони є віддаленими у часі. Разом з тим. можна припустити, що віддалені у часі зміни в експресії ендотеліну-1, Р-селектину та тканинного фактора можуть бути і у випадку короткотривалої дії пропофолу, але відповідь на це припущення можуть дати лише подальші детальні дослідження. Посилення експресії ендотеліну-1, Р-селектину та тканинного фактора під впливом пропофолу необхідно враховувати при виникненні різного роду ускладнень внаслідок його використання [19]. Ці принципово нові дані щодо впливу пропофолу на експресію генів Р-селектину. тканинного фактора та ендотеліну-1 заслуговують на подальше поглиблене дослідження з метою пошуку можливих способів протидії підвищенню експресії протромботичних факторів.


Висновки.

Показано, що експресія мРНК Р-селектину. тканинного фактора та ендотеліну-1 у культурі артеріальних ендотеліальних клітин суттєво не змінюється протягом перших шести годин дії пропофолу у різних дозах.

Встановлено, що при тривалій дії пропофолу (16 та 24 години) експресія мРНК Р-селектину. тканинного фактора та ендотеліну-1 у культурі артеріальних ендотеліальних клітин спостерігається значне посилення експресії мРНК як ендотеліну-1, так і Р-селектину та тканинного фактора під впливом як меншої, так і більшої дози пропофолу, що може приводити до порушення системи гомеостазу і ініціації тромбоутворення, зокрема.

Результати даної роботи свідчать про виражену дію пропофолу на експресію мРНК Р-селектину, ендотеліну-1 та тканинного фактора при тривалій його дії на ендотеліальні клітини артерій.


^ СПИСОК ЛІТЕРАТУРИ

  1. Manduteanu I., Pirvulescu M, Gan A.M., Stan D., Simion V., Dragomir E., Саlіn M., Manea A., Simionescu M. Similar effects of resistin and high glucose on P-selectin and fractalkine expression and monocyte adhesion in human endothelial cells // Biochem. Biophys. Res. Commun. - 2010. - 391. N 3. P. 1443 - 1448.

  2. Polgar J., Matuskova J., Wagner D.D. The P-selectin. tissue factor, coagulation triad // J. Thromb. Haemost. -2005. -3. - P. 1590- 1596.

  3. Scalia R., Hayward R., Armstead V.E.. Minchenko A.G., Lefer A.M.: Effect of recombinant soluble P-selectin glycoprotein ligand-1 on leukocyte-endothelium interaction in vivo: role in rat traumatic shock // Circ. Res. - 1999. - 84. - P. 93 - 102.

  4. Scalia R., Armstead V.E.. Minchenko A.G., Lefer A.M.: Essential role of P-selectin in the initiation of the inflammatory response induced by hemorrhage and reinfusion // J. Exp. Med. - 1999. - 189. - P. 931 - 938.

  5. Iwamoto M., Mizuiri S., Arita M., Hemmi H. Nuclear factor-kappaB activation in diabetic rat kidney: evidence for involvement of P-selectin in diabetic nephropathy // Tohoku J. Exp. Med. - 2005. - 206. N 2. - P. 163 - 171.

  6. Glowinska B., Urban M., Peczynska J., Florys B. Soluble adhesion molecules (sICAM-1, sVCAM-1) and selectins (sE selectin, sP selectin. sL selectin) levels in children and adolescents with obesity, hypertension, and diabetes // Metabolism. - 2005. - 54. N 8. P. 1020 - 1026.

  7. Aref S., Sakrana M., Hafez A.A., Hamdy M. Soluble P-selectin levels in diabetes mellitus patients with coronary artery disease // Hematology. - 2005. - 10, N 3. - P. 183 - 187.

  8. Kappelmayer J., Nagy B. Jr., Miszti-Blasius K., Hevessy Z., Setiadi H. The emerging value of P-selectin as a disease marker // Clin. Chem. Lab. Med. - 2004. - 42. N 5. - P. 475 486.9. Thanaporn P., Myers D.D., Wrobleski S.K.. Hawley A.E.. Farris D.M., Wakefield T.W., Iienke P.K. P-selectin inhibition decreases post-thrombotic vein wall fibrosis in a rat model // Surgery. - 2003. - 134, N 2. - P. 365 - 371.

  9. Armstead V.E., Minchenko A.G., Campbell B., Lefer A.M.: P-selectin is up-regulated in vital organs during murine traumatic shock. FASEB J., 1997, vol. 11. p. 1271-1279.

  10. Jiao J.A., Kelly A.B., Marzec U.M., Nieves E., Acevedo J., Burkhardt M., Edwards A., Zhu X.Y.. Chavaillaz P.A., Wong A., Wong J.L., Egan J.O., Taylor D., Rhode P.R., Wong H.C. Inhibition of acute vascular thrombosis in chimpanzees by an anti-human tissue factor antibody targeting the factor X binding site // Thromb. Haemost. - 2010. - 103. N 1. - P. 224 - 233.

  11. Hackeng T.M., Maurissen L.F.. Castoldi E., Rosing J. Regulation of TFPI function by protein S. J. Thromb. Haemost. 2009. - 7. Suppl. 1. - P. 165 - 168.

  12. Jing Y., Jian-Xiong Y. Human tissue factor pathway inhibitor-2 suppresses the wound-healing activities of human Tenon's capsule fibroblasts in vitro // Моl. Vis. - 2009. - 15. -P. 2306-2312.

  13. Armstead V.E., Opentanova I.L., Minchenko A.G., Lefer A.M.: Tissue factor gene expression in vital organs during murine traumatic shock: role of transcription factors AP-1 and NF-kB // Anesthesiology. - 1999. - 91. - P. 1844 - 1852.

  14. Armstead V.E., Opentanova I.L., Minchenko A.G., Lefer A.M.: Trauma results in elevated tissue factor in plasma and tissues // Trauma Care. - 1999. - 9. - P. 57.

  15. Minchenko A.G., Caro J.: Regulation of endothelin-1 gene expression in human microvascular endothelial cells by hypoxia and cobalt: role of hypoxia responsible element // Моl. Cell. Biochem. - 2000. - 208. - P. 53 - 62.

  16. Minchenko A.G., Armstead V.E.. Opentanova I.L.. Lefer A.M.: Endothelin-1, endothelin receptors and ecNOS gene expression in vital organs during traumatic shock in rats // Endothelium. - 1999. - 6. - P. 303 - 314.

  17. Dimitrijevic I., Ekelund U., Edvinsson M.L., Edvinsson L. Increased expression of endothelin ET(B) and angiotensin AT(1) receptors in peripheral resistance arteries of patients with suspected acute coronary syndrome // Heart Vessels. - 2009. - 24, N 6. - P. 393 - 398.

  18. Ahlen K., Buckley C.J., Goodale D.B., Pulsford A.H. The "propofol infusion syndrome": the facts, their interpretation and implications for patient care // Eur. .1. Anaesthesiol. -2006.-23. P. 990-998.

  19. Armstead V.E., Minchenko A.G., Schuhl R.A., Lefer A.M. Regulation of P-selectin in human endothelial cells by nitric oxide // Amer. J. Physiol. - 1997. - 273. - P. H740 - 11746.

  20. Minchenko D.O., Bobarykina A.Y., Ratushna O.O., Marunych R.Y.. Tsuchihara K., Moenner M., Caro J., Esumi H., Minchenko O.H. Dominant-negative constructs of human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4: effect on the expression of endogenous 6-phosphofructo-2-kinase/fructose-2.6-bisphosphatase mRNA. Біотехнологія. 2008, № 4. 49-56.


Схожі:

Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconМінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г
Експресія р-селектину, тканинного фактора та ендотеліну-1 в ендотеліальних клітинах повздовжньої артерії: вплив пропофолу
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconВолик ілонна миколаївна
Науковий керівник – кандидат економічних наук, доцент Мінченко Микола Васильович, Українська академія
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconМінченко Т. А, методист українознавства іппочо
У рамках серпневих інструктивно-методичних нарад педагогічних працівників Чернівецької області відбулися секційні засідання вчителів...
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconУкраїнознавство Т. А. Мінченко
Головними завданням українознавства є плекання в учнів щирих почуттів любові до неньки – України І до всього українства, шанування...
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconМетодичні рекомендації для використання в роботі. Директор Г.І. Білянін Мінченко Т. А. Осовська О. П. 52-73-36 Додаток
Чернiвцi, вул. I. Франка, 20; тел./факс: (0372) 52-73-36, е-mail: cv ipo@ukr net, ipo@cv ukrtel net
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconМінченко Т. А., методист українознавства оіппо на Івана, на Купала…
Купала – це день літнього сонцевороту, що тепер сходиться з християнським святом Різдва Івана Хрестителя – 24 червня за старим стилем,...
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconУкраїнознавство
О. В.) рекомендованою Міністерством освіти І науки України, лист №1/іі-3517 від 30. 09. 08 р з творчим використанням «Орієнтованого...
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconТ. А. Мінченко, методист українознавства іппочо першоосновою життя на землі є сім’Я. Сім’я – це об’єднання людей, що грунтується на шлюбі або кровній спорідненості, пов’язаних спільністю побуту І взаємною відповідальністю.
Першоосновою життя на землі є сім’Я. Сім’я – це об’єднання людей, що грунтується на шлюбі або кровній спорідненості, пов’язаних спільністю...
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconТема: Патогенетичне обгрунтування вибору тактики та об’єму оперативних втручань при гострій та хронічній хірургічній патології
Науковий керівник Безродний Б. Г., завідувач кафедри хірургії №2 нму, доктор медичних наук, професор
Мінченко Д. О., Сенченко Т. Ю., Безродний Б. Г мінченко О. Г iconДокументи
1. /Управл_ння персоналом та економ_ка прац_/Маг_стри/_ващенко Євген Олександрович маг..doc
Додайте кнопку на своєму сайті:
Документи


База даних захищена авторським правом ©zavantag.com 2000-2013
При копіюванні матеріалу обов'язкове зазначення активного посилання відкритою для індексації.
звернутися до адміністрації
Документи